Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0441
Clone ID AG0441
Vector pGT0lxr
Project sanger

Sequence tag AG0441
Sequence
GCAAGTGCGTCCAACATGGCGTCGGAGCGCAAGACTAAGTTATCCAAGAACCTGCTGCGCATGAAGTTCATGCAAAGAGG
CCTGGACTCGGAAACCAAGAAACAGCTAGAAGAGGAGGAGCGGAAGATGATCAGCGACGAGCACTGGTACCTGGATTTGC
CGGAGTTGAAGGAGAAGGAGAGCTTCATCGTAGAGGAGCAGAGCTTCTCCCTGTGTGAAGATCTTCTCTACGGAAGGATG
TCATTCAGGGGGTTTAATCCTGAGGTTGAG
Sequence Type mRNA
Unitrap ID UNI2117

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 120318481..120325817 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031843 (Mphosph6) NM_026758 M phase phosphoprotein 6 Gene [Source:MGI Symbol;Acc:MGI:1915783]

 
Come back to gene ENSMUSG00000031843


For any suggestions or comments, please send an email to unitrap@crg.es