Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0231
Clone ID AG0231
Vector pGT0lxr
Project sanger

Sequence tag AG0231
Sequence
ATAAATCCAAGAAAGGAGGTAAAATGCGCCAGGTTTCACTGAGCAGCTCGGAGGAGGAGCTGGCATCCACACCTGAGTAT
ACAAGCTGTGATGATGTGGAGCTGGAAATGCGAGAGTGTGAGTGAGAAAGGAGACATGGAGTACAGCTGGTTGGAGCAAG
CGTCTTGGCATAGCAGTGAGGCGTCCCCAATGTCTTTGCACCCTGTGACCTGGCAGCCATCCAAAGATGGAGATCGCCTA
ATTGGTCGTATTTTATTAAATAAGCGTTTAAAAGATGGGAGTGTACCTCGAGACTCAGGAGCAATGCTGGGCTTAAAG
Sequence Type mRNA
Unitrap ID UNI4300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39269340..39286025 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]

 
Come back to gene ENSMUSG00000037386


For any suggestions or comments, please send an email to unitrap@crg.es