Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST348840
Clone ID OST348840
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST348840
Sequence
GACTGAGAGTTTCCTGAGCTGACACTGATGGTAGTCTGGCAGAAAGGACAGCCTTCGTTAACATGCTTACCTGCAGCCAG
GTGCACTTCAAGTAATGCGCACTGCGGGCCCTTGCAAAGGGTCTTCTCTCCGCACAAAACAAAAAGGGGGAAAAGAGTGA
GTTAATTTTCAGAGCCTGAAAAATAGACATCACGTGAACTTCTGCAGCAGAAAAGAAGAGTGATCCTGAAGAGATGCTTT
GACAGATGAAGGTGGAGAGGAGATCCCGTCTCAGCCACGTCTCCTGAGGAGAAGTGTCAGCATCAGGGCAGCAGTGAGGA
TGGAGAGGGCGCAGACTGTGGGGACCACAATCTCTGAAGCCACGTGCATGTGCCTAAGCAAGGGCTCTGAAAGGGACAGA
TACATCCACCAGAAGTGAGCTGTGTTTTGAAACAAAAGCTAAAGGAGATGGGCCACTGCGTTTCTAATTTTTCTTATTTG
TTGTAAAAGTGAACCAGTAAATCAAACATTATTT
Sequence Type mRNA
Unitrap ID UNI12220

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63985485..63987825 384
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032400 (Zwilch) NM_026507 Zwilch, kinetochore associated, homolog (Drosophila) Gene [Source:MGI (curated);Acc:Zwilch-001]

 
Come back to gene ENSMUSG00000032400


For any suggestions or comments, please send an email to unitrap@crg.es