Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST348686
Clone ID OST348686
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST348686
Sequence
GACTGAGAGGCGAGCACCGTCAGGACGCANTGCCCGGCCCTACTAGAGACCTGCAGAGCTGCATTGACGACCAGATTTAT
TTTTTAAACCAGAAAATGTTNTAAATTTATAATTCCATATTTATAATGTTGGCGACAACATTATGATTATTCCTTGTCTG
TACTTTAGTATTTTCACCATTTGTGAAGAAACATTAAAACAAGTTAAATAGTAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4969900..4970108 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es