Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST348667
Clone ID OST348667
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST348667
Sequence
ACTGAGAAGGAAGATGAAGGCCCGTGCTCCGCCCCTCCTGGAAAGCCTGCTGCCCAGAATGTCCACAGCGAACAGAAACT
GCCCCATGATGCCACCCTGGGATCCCAGCAAAGCCTGGTCTACATGAAGGAGGCACTGCAGAACAGCACCTTGGACATCA
CCGTGGTTCTGCCCAGTGGACTGGAGAAGCAGAGTGTGGTTAGTGGGAGATTGTGGCATCTGGACAATAATTCACAAATT
TTGCTTGACAAGCACAAGGAAAGGTGGAGTTCCTCCTAGAAAGTAAAAATGTTTCTGGAAAATGCTTTCAAGTGAATATA
CTGTGCTCTCTCTGCCTTCAGTACCTTTTCCCCTATAGAGCA
Sequence Type mRNA
Unitrap ID UNI15950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12285640..12286771 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]

 
Come back to gene ENSMUSG00000020173


For any suggestions or comments, please send an email to unitrap@crg.es