Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST348464
Clone ID OST348464
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST348464
Sequence
GAGCCCTGCTTCATGTTGTGCTGATGCTGGTCTGCCATGCTAGCCTGTCTCCCAGGACCAGGTGACCTGTCCCTTCAGCT
TCTTTCTCACACGCAGATGAACACTGGACTTCAGAAATGTCTTCCTCTTGGGTTTCAAGTAAAGATGGCTACCTCGACAC
GGAGAGGAGATTAGACAGAGAAGAACTCAGAAGCAGATCTGATTTAGNTCCTATGTGAACTAAATAAAACCCAGCACTTT
CAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16325

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77956598..77961939 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037750 (BC017647) NM_145430 Uncharacterized protein C17orf63 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6P539]

 
Come back to gene ENSMUSG00000037750


For any suggestions or comments, please send an email to unitrap@crg.es