Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST348410
Clone ID OST348410
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST348410
Sequence
CATCTCTGGGGCCCACATGAATGCCGNAGTGACGTTTCACCAATTGNGCACTAGGCCGAATGACCTGGAAGAAGTTCCCT
GTATATGNGCCTGGGTCAGTTCCTGGGCTCCTTCTCAGCTGCAGCTACCACCTACTTAATTTTCTATGGTGAGCAGTCTT
CCTGGATTGNCTACCTCCAGCCTCTTTTACTGAAGCATGGCTGGATTCCATCTTG
Sequence Type mRNA
Unitrap ID UNI20913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40982459..40982664 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028427 (Aqp7) NM_007473 aquaporin 7 Gene [Source:MGI (curated);Acc:Aqp7-001]

 
Come back to gene ENSMUSG00000028427


For any suggestions or comments, please send an email to unitrap@crg.es