Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0333
Clone ID GC0333
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0333
Sequence
CCTGCAGCGAGCAAGCGAAGTCGCAACCCTGAGGGCTCCAGTTCCATCTCGAAGAACGTGCGTACACTTTCAGCATATAC
ATTCCCCAGGAAACAGCTCAAGGGCATCACAGGAGCCNTGNTANTNGGGAGGCTGNTCCCACTATANATGTACATTACAG
GTTTACANNTGCCNCNTNGGGTAA
Sequence Type mRNA
Unitrap ID UNI71

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107764924..107765040 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es