Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0135
Clone ID AG0135
Vector pGT0lxr
Project sanger

Sequence tag AG0135
Sequence
CCCACACGGGCTGCTGGGAAGAGAAGGAGGAAGTGACCATGGACACCAGTGAAAACAGACCTGAAANTGAGGTGCCTGAG
CCTCCTCTGCCTGTTGCAGACCAAGTCAGCAATGATGAGCGCCCAGAGGGCGGTGCTGAAGAAGAGGAAAAGAAAGAGAG
TTCGATGCCCAAGTCATTCAAGAGGAAAATCTCCGTTGTCTCAGCTACCAAGGGGGTGCAAGCTGGAAACAGTGACACAG
AGGGGGGCCAGCCTGGTTGAAAAAGCGCGTGTTGGGGAGCCAGCACTGCTGCGACACAGAAGAAACCGTCCATCAGTATC
ACCACTGAGTCACTCAAG
Sequence Type mRNA
Unitrap ID UNI4309

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55265540..55270694 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022185 (Acin1) NM_023190 apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]

 
Come back to gene ENSMUSG00000022185


For any suggestions or comments, please send an email to unitrap@crg.es