Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0132
Clone ID AG0132
Vector pGT0lxr
Project sanger

Sequence tag AG0132
Sequence
AGAGTCCTGACACTGTGACAATACACGCTGCCACACCACAGTTCATCATTGGACCNGGAGGGGTGGTGAACCTCACAGAT
GAAACAGGAGTATCTGCTGTTCAGTTTGGAAACTCCTCTACGTCAGTATTAGCTACGTTAGCTGCCTTAGCTGAAGCTTC
TGCCCCATTGTCCAATTCTTCAGAAACTCCAGTAGTGGCCACAGAGGAAGTGGTTACCGCAGAATCTGTGGATGGTGCAA
TTCAGCAAGTAGTTAGCTCAGGGGGTCAGCAAGTCATCACGATAGTTACAGATGGAATCCAGCTGGGGAATTTGCACTCC
ATACCAACCAGTGGGATGGGTCAGCCCATCATTGTGACGATGCCCGATGGACAGCAAGTATTGACAGTACCAGCAACAGA
CATTGCTGAAGAAACTGTCATCAGTGAAGAGCCACCAGCTAAGAGACAGTGTATGGAAATAATTGAGAGCCGGGTGGAAT
GTGCAGAAATTGAA
Sequence Type mRNA
Unitrap ID UNI4310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126464965..126476322 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027361 (Gabpb1) NM_207669 GA repeat binding protein, beta 1 Gene [Source:MGI (curated);Acc:Gabpb1-003]

 
Come back to gene ENSMUSG00000027361


For any suggestions or comments, please send an email to unitrap@crg.es