Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0121
Clone ID AG0121
Vector pGT0lxr
Project sanger

Sequence tag AG0121
Sequence
GGGAGCTTTTCCAGGGGGTTTTTTTTTTACTCCAAACACCATAGTCGGACTATCCCAAAGGATATGCGGAAAAAGATCAT
GACAGGAAGTTTCGAGTTCCCAGAAGAAGAGTGGAGCCAGATCTCAGAGATGGCTAAAGATGTTGTGAGGAAGCTTCTGA
AGGTCAAACCAGAGGAAAGACTCACAATCGAGGGAGTGTTGGACCATCCCTGGCTCAACTCGACAGAGGCCCTGGATAAT
GTGCTACCCTCTGCCCAGCTGATGATGGATAAG
Sequence Type mRNA
Unitrap ID UNI4313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121978879..121981670 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029454 (Mapkapk5) NM_010765 MAP kinase-activated protein kinase 5 Gene [Source:MGI (curated);Acc:Mapkapk5-005]

 
Come back to gene ENSMUSG00000029454


For any suggestions or comments, please send an email to unitrap@crg.es