Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0117
Clone ID AG0117
Vector pGT0lxr
Project sanger

Sequence tag AG0117
Sequence
CACCGCCCTCCACGATTCCAGCAAGCGCAAGCAGCTGGACAGCGACGGCCAGCCAGACTCTGTCCCCAGTGTGAAGAGGA
GGCGGCTGATACCCGAGGCGCTCCTGGCCGGCATGCGCACCCGTGAGAACAGTTCGCCCTGCCAGGGAAATGGAGAGCCT
GCCAGCAGGGGCAGGAGTGGAAGCTGTGCATGGCCTGCAGAAGAGGAACCTTCCACTGAGGCCACTGTCCCTTCCTACAA
GAAGCCCCTGTATGGCATCTCCCACAAGATCATGGAGAAGAAGAACCCTCCCTCGGGAGACCTGCTCAGCCCCTATGAGC
TCTTTGAGAAGGCAAACTCCAGTAGCGGCCCTTCTCCCCTGCGCCTGCTCAGTGAGTCTCAGAAGCGGGAATGTGGTGTC
GGGGTTGCCCCCCCCCACCCCCGTATTGCAACCTCTAGCTAGCTAGGGTGGCTTGGGTTGTGGATAAGTAGCTAGACTCC
AGCAACCAGTAACCTCTGCCCTTTCTCCTCCATGACAACCAGGTCCCA
Sequence Type mRNA
Unitrap ID UNI4314

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 43214052..43229967 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038214 (AK122525) NM_199028 BEN domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2677212]

 
Come back to gene ENSMUSG00000038214


For any suggestions or comments, please send an email to unitrap@crg.es