Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST347853
Clone ID OST347853
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST347853
Sequence
ACAGGCAGCCGTCTCCTGCACTGAAGTCAGGNGGAGCAAGGAGTGTGTCAAGGTGGCGTCATCCACACNTCTTCCACTGT
GGCAGGGTGATGACCCAAGCCACAGTCCTATGCCCCCTCAGGCCAGAGTGTGTTTGCNCGGAGACCAGGATGCTCGGGAG
AGGTGGACACTGCCCTTTGCAGCACTCAACCCACTGGAGGTGTGGTCAGAGTTGCCGTGCTGAATATCAGCATTGNAAAT
GCTTTCATTTAACCCACAGCACAACCCAGCTTTAACCTTCGTCCGCCCATAAGTGCATGAGCATNTGCATTAGCTCTGAA
GACTTNTGCCCTCGGCTCCTCATACATTTAATCACATTTACACACCAATTTTATAAAAATAGCAGTGTAGAT
Sequence Type mRNA
Unitrap ID UNI7190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151677490..151677876 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039662 (Icmt) NM_133788 isoprenylcysteine carboxyl methyltransferase Gene [Source:MGI (curated);Acc:Icmt-001]

 
Come back to gene ENSMUSG00000039662


For any suggestions or comments, please send an email to unitrap@crg.es