Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST347742
Clone ID OST347742
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST347742
Sequence
TGAGGTCTTGATGCAGAGCTTTACTATGTGAGAAATGACCTCATCAGTCACTACGCTCTGTCCTTTAACCTGCTAGTGCC
CAGTGAGACAAACTTCCTGCACTTCACTTGGCATGCAAAGTCCAAGGTTGAATATAAGCTGGGATTCCAAGTAGACAACT
TTGTGGCTATGGGCATGCCCCAGGTCAATATTTCTGCTCAAGGGGAGGTCCCACGCACTTTATCAGTGTTTCGGGTCGAG
CTTTCTTGTACCGGCAAAGTCGACTCTGAAGTCATGATTCTAATGCAGCTCAATCTGACAGTGAATTCCTCAAAAAATTT
TACAGTTTTAAATTTTAAACNANGGAAAATGNGCTACAAAAAACTTGAAGAAGT
Sequence Type mRNA
Unitrap ID UNI20943

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 102764202..102771738 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032547 (Ryk) NM_013649 receptor-like tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:101766]

 
Come back to gene ENSMUSG00000032547


For any suggestions or comments, please send an email to unitrap@crg.es