Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST347689
Clone ID OST347689
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST347689
Sequence
TTGTATCAGACATGGTAGATCCGCCTGCTGCTCTTAGACTGAGGCTCTGGCCAGCAACGGCTGGAGAACATCTAGTGGCC
TAGCTCTTCCCTGGACACCTTCTGCAAAGACCCTGCGGCCAGCAGCACGTACCTTCTTCTGGACACTTACGCCTTTTTCG
GTTTCCACTTTTCTGTGTTAGAAAGTCACTGTTTCTCAGAAGGAATGTCTACAGTGATGGGTTTGCTATGCAGAAAGGTC
CCAGATTCTTTCCAATGTCTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20944

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35216501..35216941 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041445 (Mmrn2) NM_153127 multimerin 2 Gene [Source:MGI Symbol;Acc:MGI:2385618]

 
Come back to gene ENSMUSG00000041445


For any suggestions or comments, please send an email to unitrap@crg.es