Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST347673
Clone ID OST347673
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST347673
Sequence
ACTGAGGAATGGGTGAATTTAAGGTCCATCGAGTACGTTTCTTTAATTACGTTCCATCAGGTATCCGGTGTGTGGCTTAC
AATAATCAGTCAAACAGATTGGCTGTTTCACGAACAGATGGCACAGGTGGAAATTTATAACTTGTCAGCAAACTATTTTC
AGGAGAAAGTA
Sequence Type mRNA
Unitrap ID UNI20946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109418489..109418654 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041438 (Cirh1a) NP_035704 cirrhosis, autosomal recessive 1A (human) Gene [Source:MGI Symbol;Acc:MGI:1096573]

 
Come back to gene ENSMUSG00000041438


For any suggestions or comments, please send an email to unitrap@crg.es