Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0082
Clone ID AG0082
Vector pGT0lxr
Project sanger

Sequence tag AG0082
Sequence
CCCCTTTTCTTACCCTTNGTCTTCACTTTCCCAATGGGGGGCTGGGAGATGATCAGAAAAATCGTAGTCACATCAGTCAG
TTACAAATATACCTCTACATATGTGGTGAAGGCGGGCCAGACGGTCACTGTGTGGGTTGCAAATGCTGGTGTCACAACCA
TCCTTCCAACTGACATCATCTGGAAGAACCAGGAGTAGGAGGAGGAGCCCTGTAGATGTGGCGGTGGATGGATGGAGAAT
TTTCACCAACAGGAGGTTTTTTCCCCCAGGATTGTATTCGACATTTTTTTTTTTTTTTCCTCTTTCTCATTAATAGGAGG
AGCCCATCGGAGTGGCTGTGGAGGAGGAGCGTTTCCACCAGCAG
Sequence Type mRNA
Unitrap ID UNI4324

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56902871..56909463 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024590 (Lmnb1) NM_010721 lamin B1 Gene [Source:MGI (curated);Acc:Lmnb1-001]

 
Come back to gene ENSMUSG00000024590


For any suggestions or comments, please send an email to unitrap@crg.es