Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0831
Clone ID AF0831
Vector pGT0lxr
Project sanger

Sequence tag AF0831
Sequence
TTCTAGATGGTTTGGTTGTGAGCTCTTCTAGATGGTTTGGTTGTGAGCTCTTCTAGATGGTTTGGTTGTGAGCTCTTCTA
GATGGTGAAAATATTAGGCCACTGGCCTTACCTGTTGGGAGAGCAAGGCAGTTAATTGTGCTCTATACCATGGCTCACAA
TCCTAATATGACTCATCTGAAGATTAAGCAGCCAGTGACAGCCCTTCCTCCTCTTTGGGTGAGATGTGACGGTTCAGATC
CTGAAGGTACCTGTTGGCTAGGAGCTGAGCTTATCACAACAAATGACATCATTGCAGGCGTTATCCTGTATGTGCTCACT
TGTAAAGCTGATAAAAATTACTCTGAAGATCTGGAAAATTTAAAAACTTCACACAAGAAAAGACATNCAGCGTGTCCTGC
T
Sequence Type mRNA
Unitrap ID UNI4330

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64009178..64012213 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032400 (Zwilch) NM_026507 Zwilch, kinetochore associated, homolog (Drosophila) Gene [Source:MGI (curated);Acc:Zwilch-001]

 
Come back to gene ENSMUSG00000032400


For any suggestions or comments, please send an email to unitrap@crg.es