Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0800
Clone ID AF0800
Vector pGT0lxr
Project sanger

Sequence tag AF0800
Sequence
GGAGGGAAATGGATACTGCAAGAACACCTCTGAGTGAAGCTGAGTTTGAAGAAATCATGAATAGAAATCGGGCAATCTCA
AGCAGTGCTATTTCAAGAGCTGTGTCTGACGCTAGTGCTGGTGATTATGGGAGTGCTATTGAAACATTGGTAACAGCAAT
TTCTTTAATTAAACAATCCAAAGTCTCTGCAGATGATCGTTGCAAAGTTCTTATTAGCTCTCTGCAGGATTGCCTTCATG
GAATCGAGTCCAAGTCCTATGGGTCTGGATCCAGACGTGAACGATCAAGAGAACGGGACCATAGTAGATCACGGGAAAAG
AGTCGTCGCCATAAATCTCGGAGTTGAGATGGCCTTTATGACTATTACTTTTTTTTTTTTTTTGAAATGTATGCAGTTGT
CCTCCTCAGCGCTGCATCTGGATTTATGAGATGGAGTTCGGTGCAGGGAGCAGCGCCATTTTTCAGGTACCG
Sequence Type mRNA
Unitrap ID UNI4332

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 116793087..116797613 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055531 (Cpsf6) NM_001013391 cleavage and polyadenylation specific factor 6 Gene [Source:MGI Symbol;Acc:MGI:1913948]

 
Come back to gene ENSMUSG00000055531


For any suggestions or comments, please send an email to unitrap@crg.es