Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0734
Clone ID AF0734
Vector pGT0lxr
Project sanger

Sequence tag AF0734
Sequence
GCCTGTTGTTGCAGAGCAGTACTGCCGGGAACAAGAAACTGCAGCGGGCGCTAGAGGGGCGGACCTGAGGTCGCGGATTC
CGAAGCCCCAGAGGCAGATTCCGAGTGCAGTGGGTAGGAGGCTGTCCTCCGGGCCTCGCCGACCATCCTGCGGACGGACT
GGGCGTGGCCGGAGGAACTGTCCCGAAGCTGTGGGGCCTTTCATTTGGCCTTGGGAAGATCAGCAGGAGAAGGCGGGGCT
CCTCCCCACGTTTCGGCCGAAGTGGCTGCAGAGCTGAAGGGGTGGGGCCTCGGGGTAGCCCGGTGAGTGGATCCTGTCCT
CTCTCCTCAGCCCTGGACCATAGCCAGCACACACTGAGGCAGGAATGGCCCCGAGACCTCCGACGGCCAAGCCCCAG
Sequence Type mRNA
Unitrap ID UNI4334

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108939275..108939670 392
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031907 (Zfp90) NM_011764 zinc finger protein 90 Gene [Source:MGI Symbol;Acc:MGI:104786]

 
Come back to gene ENSMUSG00000031907


For any suggestions or comments, please send an email to unitrap@crg.es