Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST347190
Clone ID OST347190
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST347190
Sequence
GAGGTGCGCAGAGGACGTGGTCGCGGTGGGCGCTTTGGTTCCAGAGGAGGGCCTGGTGGAGGGTTCAGGCCTTTTGTGCC
CCATATCCCATTTGATTTTTATTTGTGTGAAATGGCTTTTCCCCGGGTCAAGCCACTACCTGATGAGACCTCCTTCAGTG
AAGCCTTGCTGAAGAGGAATCAAGACCTTGCCCCTAATTCTGCTGAGCAGGCTTCCATCCTTTCTTTGGTGACAAAAATC
AACAATGTGATTGACAACTTGATTGTGGCCCCAGGAACATTTGAAGTGCAAATTGAAGAAGTCCGGCAGGTAGGATCATA
TAAAAAGGGAACAATGACTACAGGACACAATGTGGCTGACCTGGTGGTAATACTAAAGATCCTGCCAACATTGGAAGCTG
TTGCTGCCCTGGGGAACAAAGTCGTGGAAAGCCTAAGGGCACAGGATCCCTCAGAAGTTTTGACCATGCTGACTAATGAA
ACTGGCTTTGAAATTAGCTCTTCTGATGCTACGGTGAAAATT
Sequence Type mRNA
Unitrap ID UNI6854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90280933..90288440 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001016 (Ilf2) NM_026374 interleukin enhancer binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1915031]

 
Come back to gene ENSMUSG00000001016


For any suggestions or comments, please send an email to unitrap@crg.es