Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST346452
Clone ID OST346452
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST346452
Sequence
TAAGCTCCAGGCGTTTCTTCCAAAGCAAAGGGTTCCAGTGCCCTCTGCTGATGTCTGCTGGTACCAGATGTATGGGACGC
ACATGCACATGAAGACATGCAAGCAAAAATAATAAAA
Sequence Type mRNA
Unitrap ID UNI15599

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91428886..91429680 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040549 (Ckap5) NM_029437 cytoskeleton associated protein 5 Gene [Source:MGI (curated);Acc:Ckap5-001]

 
Come back to gene ENSMUSG00000040549


For any suggestions or comments, please send an email to unitrap@crg.es