Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST346404
Clone ID OST346404
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST346404
Sequence
GACTGAGGATGACTTTAGGAATCTTTGCAAATTGTATATTCTGCTTGAAGGTCAAGTACTTACCTCGTCAGCAGAAGAAA
AAGCTGCAAACTGATATTAAGGAAAATGGCGGAAAGTTTTCCTTTTTATTAAACCCTCAGGGCTNNCCTGTCATNAGTAA
ACAGNGCTGACGTCCTGAGTCGGTGTCATCTGAACTCCATCCAAAAGAACGATGTGCAGATTGCCAACCCAGCATTCATC
CAGGACTCTGTGAGACAGAGGAGACTCCTGGATGTGAGGAATTATGATCCTCTGTCGCCGGCTCCAGCAGCACCACCAGC
TGAAAGGAGCAGGTCTGAAACAAACAAAATCCTGAAGGATGACGGCAGATCGAGATGTTTCTTCTCTGATCAGACCCAAA
ATGACCTGGAGACTCTCATGGTTTCAGAATATTTGATATACAATTTTGAAAAATA
Sequence Type mRNA
Unitrap ID UNI20992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 57202994..57204837 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054509 (Parp4) poly (ADP-ribose) polymerase family, member 4 Gene [Source:MGI Symbol;Acc:MGI:2685589]

 
Come back to gene ENSMUSG00000054509


For any suggestions or comments, please send an email to unitrap@crg.es