Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0338
Clone ID AF0338
Vector pGT0lxr
Project sanger

Sequence tag AF0338
Sequence
TCTCCTGTTGTATAGCCCAGTCGGTGGAAANGTNTGGANTACCTGTNGAGCAAACAAACAAAAGCGTCACCTTCTGGAGG
CCNTCTGGNTGAGCTGTGGTGGTGCGGGGATGAAGGTTTGGCTCCCTTTTTTNCCCCAGGGATCATCGCAAGCCCCACTC
CTTCCTGTCCCAGCGGATCATGCTGCCGTTTCATATCAACATTTACCCCCTGGCCGTTCTGTTTGAAGACGCGTTGGTCC
TTGGTGCTGTCAACGACACTCTCCTCTATGATTCTCTGTATACCCGGAGCAGTGCCAGGGAGCAGCTGGAGGTGCTCTTT
CCCTTCTGTGTTGTGGAGAGGACCTCTCAGATCTACCTCCACCATATCCTCCGCCAGCTCCTGGTCAGGAACCTGGGCGA
GCAGGCGCTCCTCCTGGCTCAGTCCTGCGCTGCGTTACCTTACTTCCCTCACGTGTTGGAGCTGATGCTCCACGAGGTGC
TGGAGGAAGAAGCTACCTCCCGGGAGCCCATTCCCGACCCGCTGCTGCCCACCGTGGCCAAGTTCATCACCGAGTTCCCC
CTCTTCCTTCAGACAGTCGTGCACTGTGCCAGGAAGACTGAGTATGCTCTGTGGAATTACCTTTTTGCAGCTGTCGGAAA
CCCCAAGGATTTATTTGAGGAATGTTTGATGGCTCAGGATTTGGACACAGCTGCCTCTTACCTTATTATCTTACAG
Sequence Type mRNA
Unitrap ID UNI4353

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 29669774..29670489 689
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038658 (C030046E11Rik) NM_001081319 RIKEN cDNA C030046E11 gene Gene [Source:MGI Symbol;Acc:MGI:1924893]

 
Come back to gene ENSMUSG00000038658


For any suggestions or comments, please send an email to unitrap@crg.es