Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0314
Clone ID AF0314
Vector pGT0lxr
Project sanger

Sequence tag AF0314
Sequence
GTGGGATTTTTGTGGGGGGGGGGGTTTTTTTTTTTTTAGGGGGGGTTTTGCGACCTATCCAGGAGGGGCGGGCGGGATCC
CCGGGGGGGGGGGTGTTTTTTTTTTGAAGGGTGGGGTGGCGAGTTTTTTAAAAGGTTTTTTTTTTTTTTGGAGGAGGCCT
GCATATCGAACCTTTATTAAAGGAAAAAATTACTTGAAGCAACGGGATGACATCATGGTCAGTAGGCCAGCAAAGAAGCA
CCTAGAGGGGTATGACAAGGATCTGAAAAGCTTTCGGGTCTCACAGGCCCTCGACAGAGTCCTGGAG
Sequence Type mRNA
Unitrap ID UNI4354

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99021884..99124308 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041747 (Utp15) NM_178918 UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2145443]

 
Come back to gene ENSMUSG00000041747


For any suggestions or comments, please send an email to unitrap@crg.es