Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST346168
Clone ID OST346168
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST346168
Sequence
ACTGAGTGCTCAGGAGCTGTCCCAAGNAAATCAAGGCTTTTTTGACCGGTGTAGACCCTATTCTGGGCCACCAGCTCTCA
GNTCGTGAACATGCTCGATGTGGTCTTAAAAAAGATAA
Sequence Type mRNA
Unitrap ID UNI17521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8969247..8969348 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071652 (Ints5) NM_176843 integrator complex subunit 5 Gene [Source:MGI Symbol;Acc:MGI:1923578]

 
Come back to gene ENSMUSG00000071652


For any suggestions or comments, please send an email to unitrap@crg.es