Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0301
Clone ID AF0301
Vector pGT0lxr
Project sanger

Sequence tag AF0301
Sequence
AAGGACACCAATGTCATGTTGGTAGCTTTGGCAGCAAAATGTCTTACTGGCTTAGCTGTTGGGCTCAGAAAGAAATTTGG
ACAATATGCAGGACATGTTGTGCCAACAATTTTGGAAAAATTCAAAGAAAAGAAGCCTCAAGTGGTACAAGCCCTGCAGG
AGGCAATTGATGCAATCTTCCTCACTACCACACTACAGAACATCAGTGAGGATGTCTTAGCAGTAATGGATAATAAAAAT
CCCACCATCAAGCAGCAGACATCACTTTTTATTGCAAGAAGCTTTCGTCACTGCATTCTTTTTCTTTTTCGAAGAGTCTA
CTAAAACCCTTTTGTGCTGCTCTACTTAAGCACATCAATGATTCTGCTCCTGAAGTCAGAGATGCTGCATTTGAAGCACT
GGGTACAGCTTTGAAGGTGGTTGGTGAGAAATCAGTAAACCCATTTTTAGCTGATGTTGACAAACATCAAACCTTGATAG
GG
Sequence Type mRNA
Unitrap ID UNI4356

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91400973..91404606 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040549 (Ckap5) NM_029437 cytoskeleton associated protein 5 Gene [Source:MGI (curated);Acc:Ckap5-001]

 
Come back to gene ENSMUSG00000040549


For any suggestions or comments, please send an email to unitrap@crg.es