Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0219
Clone ID AF0219
Vector pGT0lxr
Project sanger

Sequence tag AF0219
Sequence
GCCGTGAGACAGCAGGAGTTAGGCGCGATGCTTTCCACTGCTGCTTACCGAGACGTGGAACGAGAGCTGGAATGGGGCCT
CAGGTCTCCGCCGGCCCTGTGCAGCTGCGGTTTTTCGCCCTTATGCCCTTCAACGGAGGGTACTGTATTGGCAATTGCTG
GAGAAGATTTTTTCCATTGGTCGCTTTCAGACCACTCGATTGAGTGAAGGATTTTTCGAATTTCTTACCCGAGATAGCCC
CAAATGCTACAAACTGACAGACAAGACAGTAATTGGCTGCAGTGGTTTTCCATGGAGATTGTCTCACTTTGACAAAGATT
ATTGAAGCAAGATTAAAG
Sequence Type mRNA
Unitrap ID UNI4362

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15630062..15635253 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014769 (Psmb1) NM_011185 proteasome (prosome, macropain) subunit, beta type 1 Gene [Source:MGI Symbol;Acc:MGI:104884]

 
Come back to gene ENSMUSG00000014769


For any suggestions or comments, please send an email to unitrap@crg.es