Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST345839
Clone ID OST345839
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST345839
Sequence
GACTGAGCATGTGTCCATGGCTTGTGTTCACCTGGCTTCCAAAATAGAAGAGGCTCCGAGACGAATCAGGGATGTCATCA
ATGTATTCCATCGCCTTCGGCATCTGAGAGAGAAAAAGAAGCCTGTGCCTCTGGTGCTTGATCAAGAGTATGTTAACCTA
AAGAACCAGATTATAAAGGCAGAGAGACNGGGTTCTCAAGGAGTTGGGCTTTTGTGTCCATGTGAAGCACCCTCACAAGA
TAATCGTTATGTACCTTCAGGTGTTAGAATGTGAGCGTAATCAACACCTGGTCCAGACTGCATGGGTAGCCTCTGAGGGT
AAGTGACTAAGACTTCTCCTCTGCTGTCCAAGTGCTTTGGTGCAGGGACAGCGGCCGTCTTCAGCCAATCCAGTGCAGGC
TCTCCACCGAAGGCTGGCTCTAGACTGGTGGTATGCGCACCCGATAGTATAGTCATGGCCGACTGCTGCTGTGGTTCTCT
GACGATTGTGCTTCTTGTTAATCGTGTCATGCTTGGTAATTGTATTGATTAGAATTGATAACTGTCTTGACTT
Sequence Type mRNA
Unitrap ID UNI21015

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155187566..155192896 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029068 (Ccnl2) NM_207678 cyclin L2 Gene [Source:MGI (curated);Acc:Ccnl2-001]

 
Come back to gene ENSMUSG00000029068


For any suggestions or comments, please send an email to unitrap@crg.es