Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST345597
Clone ID OST345597
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST345597
Sequence
GAGGAACTGTCTTTCTTAGAGGAAGCACACTGTCATTTTACTCACATAAATATATGAATATATTTCTGACATTGGGGTGA
TCCAGAAGATGATAAAGAAATGATAGCAGCTCCAGAAATACCAACTGATTTTAATCTACTGCAGGAGTCATGAGACACAC
TTTTCTTCTGACACAGATTTTGAAGACATTGAAGGAAAAAATCAGAAGCANGGCAAAGGCAAACCGATGCAGGCAGAACA
CCATCAAACGCCTCTGGATTATAACACGCAGGTAACATGGATGTTAGCTCAAAGACAACAAGAGGAAGCAAGGCAACAGC
AGGAGAGAGCAGCAATGAGCTATGTTAAACTGCGAACTAATCTTCAGCATGCCATTCGGCGTGGTACAAGCCTAATGGAA
GATGATGAAGAGCCAATTGTTGAAGATGTTATGATGTCCTCAGAAGGAAGGATTGAGGATCTTAATGAGGGAATGGACTT
TGACACCATGGATATAGACTTGCCACCATCAAAGAA
Sequence Type mRNA
Unitrap ID UNI18774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39555030..39624435 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025862 (Stag2) NM_001077712 stromal antigen 2 Gene [Source:MGI (curated);Acc:Stag2-002]

 
Come back to gene ENSMUSG00000025862


For any suggestions or comments, please send an email to unitrap@crg.es