Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST345408
Clone ID OST345408
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST345408
Sequence
ACTTGGGGAAGAGGCTGNTAGAAGCTGCAAGGAAAGGCCAAGANGATGAAGTGAGGACACTGATGGCAAATGGGGCTCCA
TTCACCACAGACTGGCGTCGGAACATCACCAGCTTCACCTTGCAGCCCAGTATGGTCATTATTCCACAGCAGAAGTGCTC
CTTCGAGCTGGCGTTAGCAGGGATGCCCGGACCAAAGTGGACAGGACCCTCTTTGCATATGGCTGCAGCTGATGGACATG
TTCACATCGTGGAACTGCTTGTTAGGAGTGGTGCAGATGTGAACGCAAAGGACATGCTGCAGATGACAGCTCTGCACTGG
GCCACAGAGCACCATCACCGGGATGTCGTCGAGTTACTTATCAAATATGGAGCTGATGTCTACGCTTTTAGCAAATTTGA
TAAGTCTGCCTTTGACATAGCAATGGAGAAAAACANTACTGAGATTTTGAAAAA
Sequence Type mRNA
Unitrap ID UNI14182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95007665..95010479 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038766 (Gabpb2) NM_172512 GA repeat binding protein, beta 2 Gene [Source:MGI (curated);Acc:Gabpb2-004]

 
Come back to gene ENSMUSG00000038766


For any suggestions or comments, please send an email to unitrap@crg.es