Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST345334
Clone ID OST345334
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST345334
Sequence
ACTGAGGTTTCCCCTCAAAAAACCTATNAGGCATGGAAAGTATTTTGAACCGAGCAGTCACCAACAGATAAGAAACAGAA
AGTTGAACGCAGTTCATCCGCATGATTTTGACCCCACAGATAGCTCCTCCAAGAAGACAGAGTCTAGTTCACGAGGANAG
TAGATCCGAGATCTATGGTCTTGTTCANCGCGTGTGTGATCATNCAGAAAGACGACAATGGCTTNGGGCTGACAGTCAGT
GGAGACAATCCGGNCTTCGNACANTNTGTCAAAGAAGATGGAGCAGCCATGCGTGCTGGAGTACAAACAGGTGATCGAAT
CATCAAGGTAAAGCAGTCAGGTGTCGTGGGAGTCCTGTGGGCTGCANCGCCTGCCTCGGCTGTAGGCCTCTTTCCACCTG
GTTCTTTAGAAAAAGCAGCTCCCTGCCTTTCATACACGCTTTCTCCATTTGTTTCAAAGTTCACATTAACC
Sequence Type mRNA
Unitrap ID UNI14673

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42834120..42852372 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059495 (Arhgef12) NP_081420 Rho guanine nucleotide exchange factor (GEF) 12 Gene [Source:MGI Symbol;Acc:MGI:1916882]

 
Come back to gene ENSMUSG00000059495


For any suggestions or comments, please send an email to unitrap@crg.es