Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST345252
Clone ID OST345252
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST345252
Sequence
GACTGAGGTGGGGTCTTTCCGTGGNCGCACTTCTGGATCAGGTGGAGCGCTTCCGTGAGCAGCTGCGACGACAGGAGGAA
GGCGCTTNGGAGACCCAGCTGCGGCAGGAAGTTGAAAGACTTACAGGAGCGGTCTAGAGGAAAAACGAGAGGAGAGATGN
TTNAGCCTGATGATNCACTCTCANCNTGAGCAAAGAGAANGAGGTAGTCTTGCATTCGTGGAAGTGTGNCCGAGAAGGAT
ANANCCAGGGCCGCCAGTGATGTTCTGTGCCNATCCTTGGCTGATGAGACCCACCAACCTGCGCAGGACATTGGCAGCCA
CTGCCCACATGTGCCAACATCTGGCCAAATGTCTGGATGAACGACAGTGTGCACAGGGAGACGCTGGGGAGAAAAGCCCT
GCTGAGCTAGAGCAAACAAGCAGCGATGCTTCTGGCCAGAGTGTTATTAAGAAGTTACAGGAAGAAAATCGNCTGTTAAA
ACAGAAGGTGACTCATGTANAAGACCCTCAATGCTAAGTGGCAGCGTTATGATGCAAGTA
Sequence Type mRNA
Unitrap ID UNI21033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34842343..34856355 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059866 (Tnip2) NM_139064 TNFAIP3 interacting protein 2 Gene [Source:MGI (curated);Acc:Tnip2-002]

 
Come back to gene ENSMUSG00000059866


For any suggestions or comments, please send an email to unitrap@crg.es