Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST345126
Clone ID OST345126
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST345126
Sequence
TGAGGATTCTTCAGGTCCCCGCAGCGTATGCGCCCATTGATCCAGACTCCCCACCGTCCTTATCAACTTACTTTATGAAA
AAATGTGACCTAAAGTATGTTCTCGTTGAAAAACAGCAGCTTAGTAAATTCAAATCTTCACATGAGACAGTTCTGAACTA
TGACACAGTTTCCGTGGAACACAAGGACCTGGCACTCTTCAGACTGCATTGGGAAGATGGTCGGGTGAGCACAGTGCTTG
GTGACAGAGCAGATCAGCACAAGGTGACGGATAGAGAAGACAGAGTGAGTGCTGAGAGCAGGACCCCAGAGAAGGAGCAC
ATGGACATGCGGCATGACGGTTGCTTGGCTTATGTCCTCCATACCTCAGGGACCACGGGGACACCGAAGATTGTCAGAGT
GCCCCATGCATGCATACTGCCTAATATCCAGCACTTCCGGTAGGTCCTGTCCTTGGAATCCTTCCTGGAGTTTG
Sequence Type mRNA
Unitrap ID UNI18116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77325367..77330308 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055923 (Aasdh) NM_173765 aminoadipate-semialdehyde dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2442517]

 
Come back to gene ENSMUSG00000055923


For any suggestions or comments, please send an email to unitrap@crg.es