Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0888
Clone ID AE0888
Vector pGT0lxr
Project sanger

Sequence tag AE0888
Sequence
CTTGACTTCTTCTATTACTTCTTTCCACCCTATCCTATTTCCGCTGGACGACCGGGAGCGGAAGCGCTTCACCTACTTCT
CATCGCTGAGCCCCATGGCCAGGAAGATCATGCAGGACAAGGAGAAGATCCGGGAGAAGTACGGGCCCGAGTGGGCGCGG
CTGCCGCCCGCGCAGCAGGACGAAATCATCGACCGCTGCCTGGTGGGGCCTCGCGCCCCGGCGGCCGCCGCCGATGCGGG
GGACGTGCGGGACCCGGCGCGCGTTTCCCTGGCCTGCGCGGGCCCACGGGCCAGAAGCTGGTGCGCTTCGGCGACGAG
Sequence Type mRNA
Unitrap ID UNI4377

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127186748..127187023 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031983 (2310022B05Rik) NM_175149 RIKEN cDNA 2310022B05 gene Gene [Source:MGI Symbol;Acc:MGI:1916801]

 
Come back to gene ENSMUSG00000031983


For any suggestions or comments, please send an email to unitrap@crg.es