Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST344976
Clone ID OST344976
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST344976
Sequence
ACTGAGCATTGAGAGGTGAATGTCCGGCTGACCCTCTTCCATGTCAGGAGCTGTGTACCGGGGACGAATCCTGTCCCCAG
GGGCACAAATGCTGCAGCACAGGGTGTGGCCATGCCTGCCGCGGAGACATCGAGGGAGGGCGGGATGGTCAATGTCCCAG
AATCCTGGTAGGCCTGTGTATTGTCCAGTGCATGATGGATGAGAACTGTCAATCCGGGGAAAGGTGCTGTAAGTCAGGCT
GCGGCCGCTTCTGCATCCCAGGACTCCAGCCCCTCCAACAGCTCAAAGACTCCAACCTGACTGATGGCTTTAATTCTAAA
CTGGAGGCTCAAGCGCCCTAGCTGACCCGATTTGCTTGGCGCTCCAGGAAGCCAGGAAGGGGTGACATCCTGGGGCTTGT
GACACTCCCTGGAGTATCAGGCCTTTGCCTTGTATCTACTGCTACTTGCATGTAGCATGGAATTGCCCTGGTGCTGGGCG
CTTCTCTTTCCCAATAAAATGCTGGCATGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164556802..164559813 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000076434 (Wfdc3) NM_027961 WAP four-disulfide core domain 3 Gene [Source:MGI (curated);Acc:Wfdc3-002]

 
Come back to gene ENSMUSG00000076434


For any suggestions or comments, please send an email to unitrap@crg.es