Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0827
Clone ID AE0827
Vector pGT0lxr
Project sanger

Sequence tag AE0827
Sequence
GACGATTGGAGCCCTTAAGATGCACGATGGAATTGTGTTTTGCATTTTTTGGTAAAAGGAGCAAAGCGAGGACCTGTAGA
TATACGCTGGAGCAATCTCCTTGGAAGGATTCAGCACGAGTAGATG
Sequence Type mRNA
Unitrap ID UNI2122

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87864709..87864834 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018379 (Sfrs1) NM_173374 splicing factor, arginine/serine-rich 1 (ASF/SF2) Gene [Source:MGI (curated);Acc:Sfrs1-001]

 
Come back to gene ENSMUSG00000018379


For any suggestions or comments, please send an email to unitrap@crg.es