Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0788
Clone ID AE0788
Vector pGT0lxr
Project sanger

Sequence tag AE0788
Sequence
GCTTGGAGCAGCTGGTACCGAGAGAAGCGGGACCGGCAAAGATGATTCAGGCGATTCTGGTTTTCAACAACCATGGAAAA
CCGCGGCTGGTCCGCTTCTACCAGCGTTTTCCAGAAGAAATTCAACAGCAGATTGTTCGAGAGACTTTCCATCTGGTCCT
CAAGCGAGATGACAACATCTGTAACTTCTTAGAAGGTGGAAGTTTGATTGGTGGCTCTGACTACAAACTGATTTACCGGC
ACTATGCCACCCTCTACTTTGTGTTTTGTGTGGATTCATCAGAGAGTGAACTTGGGATCTTGGACCTCATCCAGGTTTTT
GTGGAGACACTGGATAAGTGTTTTGAGAATGTATGTGAGTTGGACTTGATCTTCCATATGGATAAG
Sequence Type mRNA
Unitrap ID UNI2618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87054721..87065503 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063801 (Ap3s2) NM_009682 adaptor-related protein complex 3, sigma 2 subunit Gene [Source:MGI Symbol;Acc:MGI:1337060]

 
Come back to gene ENSMUSG00000063801


For any suggestions or comments, please send an email to unitrap@crg.es