Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST344586
Clone ID OST344586
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST344586
Sequence
GTTTTGAGAGAATGACAGCTTGAGGCATCAGNCGTGTGGTGGTGGAATACCTGCGGGCTGTCATGCAGAAGCGTATTTCC
TTTCGGAGTGCTGAAGAGCGCAAGGAGGGCGCCGAGAAGATGGTCAGAGAGGCTGAACAGCTCCGCTTCCTGTTCCGGAA
GCTGGCGTCTGGATTTGGTGAGGATGCAGATGGACACCTGTGATACAATTGTTGCAGTGGCAGAGGTCATTAAGCTCACA
GACCCTTCTCTGCTCTATCTAGAAGTCTCAACTCTGGTCAGCAAATATCCAGACANCAGAGATGACCACATTGGTGCACT
GCTGGCACTGCGAGGAGATGCCAGCCGGGACATGAAACAGACCATCATGGAGACGCTGGAGCAGGGCCCCATGCAAGCAA
GCCCCAACTATGTACCCATCTTCAAGGAGATTGTTGTGCCCAGTCTGAACGTGGCAAAGCTCCTTAAGTAGCCCTGTCCT
CNCTGCTGCCCTATGTGCCT
Sequence Type mRNA
Unitrap ID UNI21051

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 74309492..74311598 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034152 (Exoc3) NM_177333 exocyst complex component 3 Gene [Source:MGI Symbol;Acc:MGI:2443972]

 
Come back to gene ENSMUSG00000034152


For any suggestions or comments, please send an email to unitrap@crg.es