Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0657
Clone ID AE0657
Vector pGT0lxr
Project sanger

Sequence tag AE0657
Sequence
GAATGGAATCGGGCTGATTCATCGCCTGTTCTCCGAGCCAGGTCCTTGTTGAGTGTGAGGCGCTGCCCTCGCCGCCGCGT
CGCCACAAGGCCAGGAGAGAGAGGAAAAACTACTTGTGAAAAATTGTATCTGCCAGAATTAGCAAGACTTGGAGTTAATA
ACAAATTTGTCAAATTCAACAAATTGAAGTTTAACACTGTAAGAATTACAGTTACTGAACAGAAATATGGACAGACTTCT
TAGACTTGGAGGAGGTATGCCTGGACTGGGCCAG
Sequence Type mRNA
Unitrap ID UNI1569

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 61549837..61560818 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026914 (Psmd14) NM_021526 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Gene [Source:MGI (curated);Acc:Psmd14-001]

 
Come back to gene ENSMUSG00000026914


For any suggestions or comments, please send an email to unitrap@crg.es