Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST342752
Clone ID OST342752
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST342752
Sequence
CGTGCTGAAGACACAGNAAATGAAGTGACAGTTGAACTCCGGAAGAACAAAAGAGACGAACACTTACTGAAAAAGAGAAA
TGTTCCCCAAGAAGAAAGCTTAGAAGATTCAGATGTTGATGCTGATTTTAAAGCACAAAATGTAACACATAGAAGCCTAT
ATTACAGAATGCCACAAGTGATAATCCTGTAGTCCAGTTGAGTGCTGTGCAGGCAGCAAGGAAACTATTATCCAGNGACA
GAAATCCACCANTTGATGACCTAATAAAATCTGGGATTTTACCAATTCTAAAAACCC
Sequence Type mRNA
Unitrap ID UNI7055

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62010027..62021872 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021929 (Kpna3) NM_008466 karyopherin (importin) alpha 3 Gene [Source:MGI Symbol;Acc:MGI:1100863]

 
Come back to gene ENSMUSG00000021929


For any suggestions or comments, please send an email to unitrap@crg.es