Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST342645
Clone ID OST342645
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST342645
Sequence
GACTGAGGTGCTTGTGNGACNTAAATNATTTGAACTTCTTTANTCTATATGAGNNCAGAAGCATTAGACNCAGGAGGATC
CCAGAACGGCAGCACTGAGCCCCTGCTCCCAGATCCCTCTGAACCGCCGAGCAACAGCAAAACTATGTGACAACACGTTC
TCCGCATAAAGGTTATGGTGCCCTAGGCAGTGACATATGGCCTCAGGCTGGACACCGAGACAGGTGGAAATACCCTGTCC
ATTGGTAGATGTCTTGCTTCTTCTGGTTCAGNCAGGGAAAACACATTGGACTCTTCTTGCANNACTAAAACTAACCTGGA
Sequence Type mRNA
Unitrap ID UNI21065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4706621..4706878 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004069 (Dnaja3) NM_023646 DnaJ (Hsp40) homolog, subfamily A, member 3 Gene [Source:MGI (curated);Acc:Dnaja3-001]

 
Come back to gene ENSMUSG00000004069


For any suggestions or comments, please send an email to unitrap@crg.es