Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0481
Clone ID AE0481
Vector pGT0lxr
Project sanger

Sequence tag AE0481
Sequence
TCGGCTGCGAGCCTGGGCGGCGGCGCTTGACTTCGGGGAGCCCCGTGGCTTGGCCAGCTTACTCCTCCGCTNTAAGCGTC
CGCCCCGCACTGCCTGTGAAACCCTTACAACCATGAGGGAACACCTCAAAGGCCACGAGACCCAAACCACTTGTTGGGAC
CACCCCAAAATGACAGAGCTCTACCAGTCTTTAGCTGACCTGAATAATGTCAGGTTCTCCGCGTATAGGACTGCCATGAA
GCTCAGAAGGCTCCAGAAGGCCCTTTGCTTGGATCTCTTGAGCCTGTCAGCTGCATGTGATGCCCTGGACCAGCACAACC
TCAAGCAAAATGACCAGCCCATGGATATCCTGCAGATAATTAACTGTTTGACTACAATTTATGATCGTCTGGAGCAAGAG
CACAACAATCTGGTCAATGTCCCTCTCTGTGTGGATATGTGTCTCAACTGGCTTCTCAATGTTTATGATACGGGACGAAC
AGGGAGGATCCGTGTCCTGTCTTTTAAAACTGGCATCATTTCTCTGTGTAAAGCACACTTGGAAGACAAGTACAGATACC
TTTTCAAGCAAGTGGCAAGTTCAACTGGCTTTTGTGACCAGCGTAGGCTGGGTCTTCTTCTGCATGATTCTATTCAAATC
CCAAGACAGTTGGGTGAAGTTGCTTCCTTTGGGGGCAGTAACATTGAGCCGAGTGTCAGGAGCTGCTTCCAATTT
Sequence Type mRNA
Unitrap ID UNI4390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82293665..82355439 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es