Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST342360
Clone ID OST342360
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST342360
Sequence
CTGCCAAAGAAGGGCTGCTGCTATGGTGTCAGAGGAAGACAGCTCCATACAGAAATGTGAATATCCAGAACTTNCACACC
AGGATGACCCCATAGGAAACATTAACCTGGCCATGGAAATAGCAGAGAAGCACGTTGGATATCCCTAAGATGTTGGATGC
TGAAGTATATTCAGCCTGCCGGTGNAAGTCTGTGGGAAAACTAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16260

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12386849..12398622 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052374 (Actn2) NM_033268 actinin alpha 2 Gene [Source:MGI (curated);Acc:Actn2-001]

 
Come back to gene ENSMUSG00000052374


For any suggestions or comments, please send an email to unitrap@crg.es