Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0365
Clone ID AE0365
Vector pGT0lxr
Project sanger

Sequence tag AE0365
Sequence
GAGAGGTGGTAAGAGGACTCGCGGCGGGCCGCTTCGGCTTCTTCTCGGGCCTGCTCCCTCGGCGGCTTCCCGCGCCTTCA
GCCGGCCACCATGGGGAAACGGGATAATCGCGTGGCCTACATGAATCCAATAGCAATGGCTCGATCAAGGGGTCCAATCC
AGTCTTCAGGACCAACAATCCAGGATTATCTGAATCGACCAAGGCCTACCTGGGAGGAAGTCAAGGAACAGCTGGAAAAG
AAAAAGAAGGGCTCCAAGGCTTTGGCTGAGTTTGAAGAAAAAATGAATGAGAATTGGAAGAAAGAACTAGAAAAACATAG
AGAAAAATTATTAAGTGGAAATGAGAGCTCATCCAAAAAAAGACAGAAAAAGAAAAAAGAAAAGAAGAAATCTGGTAGGT
ATTCATCTTCTTCTTCATCGAGCTCTGATTCTTCCAGCAGTTCTTCAGATTCCGAAGATGAG
Sequence Type mRNA
Unitrap ID UNI4397

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3543835..3559159 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058503 (5830415L20Rik) NM_001042501 RIKEN cDNA 5830415L20 gene Gene [Source:MGI Symbol;Acc:MGI:1915402]

 
Come back to gene ENSMUSG00000058503


For any suggestions or comments, please send an email to unitrap@crg.es