Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST341535
Clone ID OST341535
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST341535
Sequence
AACTGAGATAATATCACCTACTGCATTGTTTTTGGCTGCAAAAGTGGAAGAGCAGGCTCGAAAGCTTGAACATGTTATCA
AAGTAGCACACGCTTGTCTTCATCCCCTAGAGCCACTCCTGGACACAAAATGTGATGCTTATCTTCAGCAGACTCAAGAA
CTGGTTTTACTTGAAACCATAATGCTACAAACACNTGGGTTTTGAGATCACCATTGAACACCCACACACAGATGTGGTGA
AATGCACCCAGTTAGTAAGAGGTGAGTGGTCCCTCAACCATCTGGGATGAGTGGTGTGCTTTCTTTCCTCTAGGACTGGT
ATGGATATTGTGGATTCTAGCCTTATGTTGGGTTTTATTAAAAAGTGCAAATGTCATTTTGAAATAGTGTTCAGTATCTT
AGTCATCTACTTCTGTCTGTTTTTTCCAAGTACATTTGGTTGCATTTGTGTGGTAATGGAGAAAACTAACAACTCTCATG
CCGTTAGACCTTCTATGAGCAAGAGCCCTTCCCACGGGCTGCCAGTGTTGCTTTTCTAGTTCCCATCTGGATTGCTTATG
GTG
Sequence Type mRNA
Unitrap ID UNI10980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 129688180..129692196 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026349 (Ccnt2) NM_028399 cyclin T2 Gene [Source:MGI (curated);Acc:Ccnt2-002]

 
Come back to gene ENSMUSG00000026349


For any suggestions or comments, please send an email to unitrap@crg.es