Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST341487
Clone ID OST341487
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST341487
Sequence
GACTGAGCCTAGTGTGTTAATTGTAACATACAAGGAACCAGCTAAATCATCTACTCAGTTTGGATCTTACAAACAAGCTG
AATGGAGACCGGATAGTACCATGATAGCAGTGTCAACAGCAAATGGCTACATCTTGTTTTTTCATATTACATCTTCAAGA
GGGGATAAATACCTTTATGAACCAGTGTATCCCAAAGGAAGTCCACAAATGAAGGGGATACCTCATTTTAAGGAAGAACA
TTGTGCCCCAGCATTGAATTTAGAAATGAAGAAAATACTGGATTTGCAAGCACCCATTATGAGGTATGGTATGCTGGTTA
AGTTTGAGATTTTCTGACCACAAAAGACCATGTAGTTGATTAAATCATATGACAAACAAGAAAATTGTTTGCATTTCAAA
ATGTATAAATTAACTGTTTGATTGTATGGAATGATAACCATACTAAAAGATTCAAATAAAATCATGTATGAGAAGAAAAG
AGGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 29607653..29636763 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038658 (C030046E11Rik) NM_001081319 RIKEN cDNA C030046E11 gene Gene [Source:MGI Symbol;Acc:MGI:1924893]

 
Come back to gene ENSMUSG00000038658


For any suggestions or comments, please send an email to unitrap@crg.es