Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST341409
Clone ID OST341409
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST341409
Sequence
TTGAGGCAGCCCACAAAGGCTGGGGTGTCAGTGTGGTAGTGGGAGTAGCTGCTTCAGGGGAAGAAATCTCCACTCGTCCA
TTCCAGCTGGTGACAGGACGCACATGGAAAGGCACCGCCTTTGGAGGATGGAAGAGTGTGGAGAGTGTCCCAAAGCTGGT
GTCTGAATATATGTCCAAAAAGATAAAAGTTGACGAATTTGTGACCGGCAATCTCTCCTTCGACCAAATTAACCAAGCCT
TTGATCTGATGCACTCGGGAGACAGCATTCGAACTGTTCTAAAGATGTAAGTTCTGAAGAGAACACTGTCCATCCTGCAC
TCTTTCCTGTGATTGGCTAGAAACAGACAGGATTTACAAGCTAACCACGTCGTAGACTTCAGAAATGACTAGAAGGAATG
TGCATAATCGAGACTGTAATCATGAACTAGGCAAATTCCACATAAACAATTGCTGCTCATTGTGCAACATTTTAACATAA
TAAAAATACTTTCTGCAAAACATT
Sequence Type mRNA
Unitrap ID UNI21097

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 138116716..138118280 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028138 (Adh5) NM_007410 alcohol dehydrogenase 5 (class III), chi polypeptide Gene [Source:MGI (curated);Acc:Adh5]

 
Come back to gene ENSMUSG00000028138


For any suggestions or comments, please send an email to unitrap@crg.es