Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0088
Clone ID AE0088
Vector pGT0lxr
Project sanger

Sequence tag AE0088
Sequence
AACCCGGTATTTATTTGTTTTTCAGCTAAAACAAGATATTCTCAGTGGGAAGTGAGAGTGTCCTTTTGATACAGCAGTTC
AGTTGGCTGTTTATAATGTGCAAGTTGAATTTGGCGACTATGATCTTGTTGAATATAGTCTTGAAGTGGTTTTTTTTTTC
AGGTTTGTGCCCATCCAGATTGAAGAGATGGAACTGGCTATTTTTGAGAAGTGGATGGAATACTTTGGTCAGATTTTTTT
TACAAGCAGAAACCAATTACATGTATAATGCCGAAAGGCAGGAACATGTGTCGTTTTTCATGCATGTAGTCCAG
Sequence Type mRNA
Unitrap ID UNI4405

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 121513941..121517297 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026383 (Epb4.1l5) NM_145506 erythrocyte protein band 4.1-like 5 Gene [Source:MGI Symbol;Acc:MGI:103006]

 
Come back to gene ENSMUSG00000026383


For any suggestions or comments, please send an email to unitrap@crg.es