Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0747
Clone ID AD0747
Vector pGT0lxr
Project sanger

Sequence tag AD0747
Sequence
GTGGTGCTGGGACAGCTGCAGACACAGACATGACAACCCAGCTTATTTCTTCCAACTTGGAGCTCCACTCTCTGACCACT
GGCCGCCTCCCGAGAGTTGTTACAGCTAATCGGATGCTGAAGCAGATGCTCTTCAGGTATCAAGGTTACATTGGTGCAGC
CCTAGTTTTGGGGGGAGTAGATGTTACTGGACCTCATCTCTACAGCATCTATCGTCATGGATCAACTGATAAATTGCCTT
ATGTCACCATGGGTTCTGGCTCCTTGGCAGCAATGGCTGTGTGTGAATATAAGTTTAGGCCAGATATGGAGT
Sequence Type mRNA
Unitrap ID UNI3326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38468952..38495728 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026750 (Psmb7) NM_011187 proteasome (prosome, macropain) subunit, beta type 7 Gene [Source:MGI (curated);Acc:Psmb7-001]

 
Come back to gene ENSMUSG00000026750


For any suggestions or comments, please send an email to unitrap@crg.es